huggingface/carbon

The home of Carbon Genomic Foundation Model 🧬

215

stars

141

commits

Python

primary language

Jun 6, 2026

updated

Browse cluster: LLM Evaluation and Leaderboards

README

Carbon

Genomic foundation models from Hugging Face. Carbon is a family of causal language models trained on 1T tokens of DNA / 6T DNA base pairs from the Carbon Pretraining Corpus, a curated mix of DNA & RNA sequences.

This repo contains:

  • the eval code for Carbon tasks: sequence recovery, variant effect prediction, and perturbations. We put this together because the zero-shot DNA eval landscape is currently scattered — useful tasks live in different repos, often buried alongside evals that need finetuning or that are already saturated, which makes reproducibility harder.
  • scripts for fine-tuning the Carbon models on downstream tasks.

Contents

Models

ModelParamsNotes
HuggingFaceBio/Carbon-500M500MDraft model for speculative decoding.
HuggingFaceBio/Carbon-3B3BFlagship. Matches or beats Evo2 7B.
HuggingFaceBio/Carbon-8B8BLarger model for more performance.

The Carbon checkpoints use a hybrid tokenizer: BPE for English text and 6-mer for DNA, switched by a <dna> tag mid-sequence. That's why every inference or eval snippet below wraps DNA inputs with <dna> — see evaluation/README.md for the full DNA-tag explanation.

Installation

Install the core runtime dependencies with:

uv sync

To include evaluation dependencies, run:

uv sync --group evaluation

For Evo2-backed evaluation, install the evaluation and Evo2 dependency groups:

uv sync --group evaluation --group evo2

Inference

from transformers import AutoModelForCausalLM, AutoTokenizer

model_id = "HuggingFaceBio/Carbon-3B"
tok = AutoTokenizer.from_pretrained(model_id, trust_remote_code=True)
model = AutoModelForCausalLM.from_pretrained(
  model_id, 
  trust_remote_code=True,
  torch_dtype="bfloat16"
).to("cuda")

# DNA generation: wrap the prompt with <dna> so the tokenizer routes to 6-mer mode.
context = "ATGGCCTCGAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG"
prompt = f"<dna>{context}"
inputs = tok(prompt, return_tensors="pt", add_special_tokens=False).to("cuda")

out = model.generate(**inputs, max_new_tokens=10, do_sample=False)
print(tok.decode(out[0]))

For zero-shot variant scoring, just feed the model the full sequence and read the log-likelihood — see evaluation/vep_eval.py.

Pretraining

Training data

Carbon was trained on 1 T tokens (≈ 6 T DNA base pairs) drawn from the Carbon Pretraining Corpus mix of:

  • Eukaryote genes (animals, plants, fungi, protists) — functional genomic regions, extracted from refSeq from Generator training mix.
  • mRNA transcripts — processed, spliced mRNA from OpenGenome2.
  • Prokaryote genomes — long chromosomal chunks from bacteria and archaea (GTDB v220 + IMG/PR), included as a smaller fraction (~10 % of the training mixture).

The mixture is eukaryote-heavy by design. Carbon's target use case is eukaryote. The prokaryote share is 10% of the pretraining mixture, so the model can be continually pretrained on prokaryote species.

Pretraining code

Carbon was trained with our Megatron-LM fork: huggingface/Megatron-LM-Carbon. The fork adds:

  • Hybrid loss: the loss for bridging coarse 6-mer tokenization and single-nucleotide resolution.
  • Carbon training scripts

Evaluation

This repo ships a suite of seven zero-shot DNA evaluations with reproducible code. The benchmark datasets are available in this collection.

The suite covers four modes of zero-shot evaluation:

  • Variant effect prediction, with three established benchmarks spanning both coding (BRCA2) and non-coding regulatory variants (TraitGym Mendelian), plus ClinVar for broad pathogenic-vs-benign coverage.
  • A generative task — sequence recovery, ported from the GENERator paper.
  • Two perturbation tasks we built — CAG repeat insertion and synonymous-codon substitution — to probe regulatory-motif awareness and codon-usage structure.
  • Long-context retrieval we built — Genome-NIAH, a needle-in-a-haystack eval adapted to DNA (four tasks × six context lengths up to 786 kbp).

All eval scripts live in evaluation/. Each one runs on Carbon, GENERator, or Evo2 via a single backend flag, so numbers are directly comparable across model families.

BenchmarkWhat it measuresScript
Sequence recoveryGiven a DNA context, generate the next 30 bp; score per-base accuracy against the held-out continuation. Training-free generative eval from the GENERator paper.sequence_recovery.py
CAG repeat insertionA 30 bp codon-aligned region 60 bp into the CDS exon is replaced with 10 consecutive CAG triplets, mimicking polyglutamine expansion disorders (HD, SCAs, DRPLA). The patch is length- and reading-frame-preserving; all sequence outside is identical. The model should assign higher likelihood to the intact native sequence.perturbation_tasks.py --task motif_human
Synonymous codon substitutionCDS codons are replaced with the highest-frequency synonym for the target species (human or mouse); amino acid identity is preserved by construction. The model should prefer native codon usage over the codon-optimised variant. Probes coding-sequence structure and species-specific codon bias.perturbation_tasks.py --task syn_human / --task syn_mouse
BRCA2 VEPZero-shot VEP on saturation-mutagenesis BRCA2 (Huang 2025). Centered 8 kb window + full-LL delta.vep_eval.py
TraitGym Mendelian3,380 fine-mapped non-coding regulatory variants for 113 Mendelian diseases (Benegas et al. 2025). Centered 8 kb window + full-LL delta.vep_eval.py
ClinVarPathogenic vs benign on curated coding + noncoding ClinVar variants. Right-end / next-token scoring with 24 kb left context.clinvar_vep_eval.py (uses HuggingFaceBio/clinvar-vep-final directly)
Genome-NIAHLong-context retrieval: insert a (key, value) pair in a real-genome haystack, ask the model to retrieve the value. Four tasks × six context lengths (up to 786 kbp).genome_niah_eval.py

See evaluation/README.md for run commands, DNA-tag flags, and per-benchmark details.

Finetuning

The finetuning/ directory contains task-specific fine-tuning recipes for Carbon models:

Classification Tasks

A minimal end-to-end finetuning example (promoter detection from the Nucleotide Transformer downstream benchmark) uses the standard 🤗 Transformers Trainer with AutoModelForSequenceClassification on top of the Carbon backbone — swap in any other classification dataset by changing one flag.

See finetuning/finetune_promoter.py for the full example.

Supervised Fine-Tuning with FNS

For autoregressive DNA sequence modeling, we provide finetuning/finetune_sft.py, which uses Factorized Nucleotide Supervision (FNS) via the custom FNSTrainer. FNS applies base-pair level loss for DNA k-mer tokens, providing finer-grained supervision than standard token-level loss.

See finetuning/README.md for usage examples and detailed documentation.

Continual Pretraining

To specialise Carbon on a new clade (e.g. a specific bacterium or protist that wasn't well represented in the pretraining mix), the same scaffolding works for continual pretraining: load the model with AutoModelForCausalLM, feed it sequences with the <dna> tag, and continue training on next-token loss. The ~10 % prokaryote slice in the pretraining data means the model already has a reasonable starting point even for bacterial sequences.

Acknowledgements

Carbon is a joint collaboration between the research teams at Hugging Face, Zhongguancun Academy, and TIGEM/University of Naples “Federico II”.

License

Apache 2.0.

Contributors

lewtun

68 commits

QiuyiLi

30 commits

edbeeching

22 commits

loubnabnl

14 commits

huggingface/carbon

The home of Carbon Genomic Foundation Model 🧬

215

stars

141

commits

Python

primary language

Jun 6, 2026

updated

Browse cluster: LLM Evaluation and Leaderboards

README

Carbon

Genomic foundation models from Hugging Face. Carbon is a family of causal language models trained on 1T tokens of DNA / 6T DNA base pairs from the Carbon Pretraining Corpus, a curated mix of DNA & RNA sequences.

This repo contains:

  • the eval code for Carbon tasks: sequence recovery, variant effect prediction, and perturbations. We put this together because the zero-shot DNA eval landscape is currently scattered — useful tasks live in different repos, often buried alongside evals that need finetuning or that are already saturated, which makes reproducibility harder.
  • scripts for fine-tuning the Carbon models on downstream tasks.

Contents

Models

ModelParamsNotes
HuggingFaceBio/Carbon-500M500MDraft model for speculative decoding.
HuggingFaceBio/Carbon-3B3BFlagship. Matches or beats Evo2 7B.
HuggingFaceBio/Carbon-8B8BLarger model for more performance.

The Carbon checkpoints use a hybrid tokenizer: BPE for English text and 6-mer for DNA, switched by a <dna> tag mid-sequence. That's why every inference or eval snippet below wraps DNA inputs with <dna> — see evaluation/README.md for the full DNA-tag explanation.

Installation

Install the core runtime dependencies with:

uv sync

To include evaluation dependencies, run:

uv sync --group evaluation

For Evo2-backed evaluation, install the evaluation and Evo2 dependency groups:

uv sync --group evaluation --group evo2

Inference

from transformers import AutoModelForCausalLM, AutoTokenizer

model_id = "HuggingFaceBio/Carbon-3B"
tok = AutoTokenizer.from_pretrained(model_id, trust_remote_code=True)
model = AutoModelForCausalLM.from_pretrained(
  model_id, 
  trust_remote_code=True,
  torch_dtype="bfloat16"
).to("cuda")

# DNA generation: wrap the prompt with <dna> so the tokenizer routes to 6-mer mode.
context = "ATGGCCTCGAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG"
prompt = f"<dna>{context}"
inputs = tok(prompt, return_tensors="pt", add_special_tokens=False).to("cuda")

out = model.generate(**inputs, max_new_tokens=10, do_sample=False)
print(tok.decode(out[0]))

For zero-shot variant scoring, just feed the model the full sequence and read the log-likelihood — see evaluation/vep_eval.py.

Pretraining

Training data

Carbon was trained on 1 T tokens (≈ 6 T DNA base pairs) drawn from the Carbon Pretraining Corpus mix of:

  • Eukaryote genes (animals, plants, fungi, protists) — functional genomic regions, extracted from refSeq from Generator training mix.
  • mRNA transcripts — processed, spliced mRNA from OpenGenome2.
  • Prokaryote genomes — long chromosomal chunks from bacteria and archaea (GTDB v220 + IMG/PR), included as a smaller fraction (~10 % of the training mixture).

The mixture is eukaryote-heavy by design. Carbon's target use case is eukaryote. The prokaryote share is 10% of the pretraining mixture, so the model can be continually pretrained on prokaryote species.

Pretraining code

Carbon was trained with our Megatron-LM fork: huggingface/Megatron-LM-Carbon. The fork adds:

  • Hybrid loss: the loss for bridging coarse 6-mer tokenization and single-nucleotide resolution.
  • Carbon training scripts

Evaluation

This repo ships a suite of seven zero-shot DNA evaluations with reproducible code. The benchmark datasets are available in this collection.

The suite covers four modes of zero-shot evaluation:

  • Variant effect prediction, with three established benchmarks spanning both coding (BRCA2) and non-coding regulatory variants (TraitGym Mendelian), plus ClinVar for broad pathogenic-vs-benign coverage.
  • A generative task — sequence recovery, ported from the GENERator paper.
  • Two perturbation tasks we built — CAG repeat insertion and synonymous-codon substitution — to probe regulatory-motif awareness and codon-usage structure.
  • Long-context retrieval we built — Genome-NIAH, a needle-in-a-haystack eval adapted to DNA (four tasks × six context lengths up to 786 kbp).

All eval scripts live in evaluation/. Each one runs on Carbon, GENERator, or Evo2 via a single backend flag, so numbers are directly comparable across model families.

BenchmarkWhat it measuresScript
Sequence recoveryGiven a DNA context, generate the next 30 bp; score per-base accuracy against the held-out continuation. Training-free generative eval from the GENERator paper.sequence_recovery.py
CAG repeat insertionA 30 bp codon-aligned region 60 bp into the CDS exon is replaced with 10 consecutive CAG triplets, mimicking polyglutamine expansion disorders (HD, SCAs, DRPLA). The patch is length- and reading-frame-preserving; all sequence outside is identical. The model should assign higher likelihood to the intact native sequence.perturbation_tasks.py --task motif_human
Synonymous codon substitutionCDS codons are replaced with the highest-frequency synonym for the target species (human or mouse); amino acid identity is preserved by construction. The model should prefer native codon usage over the codon-optimised variant. Probes coding-sequence structure and species-specific codon bias.perturbation_tasks.py --task syn_human / --task syn_mouse
BRCA2 VEPZero-shot VEP on saturation-mutagenesis BRCA2 (Huang 2025). Centered 8 kb window + full-LL delta.vep_eval.py
TraitGym Mendelian3,380 fine-mapped non-coding regulatory variants for 113 Mendelian diseases (Benegas et al. 2025). Centered 8 kb window + full-LL delta.vep_eval.py
ClinVarPathogenic vs benign on curated coding + noncoding ClinVar variants. Right-end / next-token scoring with 24 kb left context.clinvar_vep_eval.py (uses HuggingFaceBio/clinvar-vep-final directly)
Genome-NIAHLong-context retrieval: insert a (key, value) pair in a real-genome haystack, ask the model to retrieve the value. Four tasks × six context lengths (up to 786 kbp).genome_niah_eval.py

See evaluation/README.md for run commands, DNA-tag flags, and per-benchmark details.

Finetuning

The finetuning/ directory contains task-specific fine-tuning recipes for Carbon models:

Classification Tasks

A minimal end-to-end finetuning example (promoter detection from the Nucleotide Transformer downstream benchmark) uses the standard 🤗 Transformers Trainer with AutoModelForSequenceClassification on top of the Carbon backbone — swap in any other classification dataset by changing one flag.

See finetuning/finetune_promoter.py for the full example.

Supervised Fine-Tuning with FNS

For autoregressive DNA sequence modeling, we provide finetuning/finetune_sft.py, which uses Factorized Nucleotide Supervision (FNS) via the custom FNSTrainer. FNS applies base-pair level loss for DNA k-mer tokens, providing finer-grained supervision than standard token-level loss.

See finetuning/README.md for usage examples and detailed documentation.

Continual Pretraining

To specialise Carbon on a new clade (e.g. a specific bacterium or protist that wasn't well represented in the pretraining mix), the same scaffolding works for continual pretraining: load the model with AutoModelForCausalLM, feed it sequences with the <dna> tag, and continue training on next-token loss. The ~10 % prokaryote slice in the pretraining data means the model already has a reasonable starting point even for bacterial sequences.

Acknowledgements

Carbon is a joint collaboration between the research teams at Hugging Face, Zhongguancun Academy, and TIGEM/University of Naples “Federico II”.

License

Apache 2.0.

Contributors

lewtun

68 commits

QiuyiLi

30 commits

edbeeching

22 commits

loubnabnl

14 commits

Languages

Python

83.0%

Shell

17.0%